EST 1868752 is a singleton


Sequence

>1868752 (1 EST) Length=445 ATGCTCGACATCGACGCGCGAGTTTTTACGGTGGCGGCGATGAAGTTCTGTGGCAACAACGGCACAGAGAGGGCCAGTTT GGACAAACGAGTTGCTATCGAGGACTGCCGTTATGCGGCGGGAAAGACAGCGGTCTTATCCGCACCAAAGACGTTGTCGG GGAAGTTACACCAGTTGCCACGCACCGGCTTTGCCCAACTTGACCTCCGTCTGCAGATGGAGGGGGTGAGTTTCTCCGTG CAGGTGCTCCCGGCGGGGCCGAGGTATTCACGATTGCCGACCTCCGTCAATTCGTTGTCGTCATTCAGAAACGGCAGCAG CGGAGGTGGCGGCTCTTTGAGGGTGAGGGTCGTGGGTGTGGTGTCACCGCTGCTGCAGTCATGAGCCGTTGGAGTGGCAA TTGGAGGGTGACTGGGTGGTGGCGAGGTGCCAATCGAATAACATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868752: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687523482759AI110339TENU3309T. cruzi epimastigote normalized cDNA Library


Date: 14:21:52 on Mon 20 Nov 117.