EST 1868760 is a singleton


Sequence

>1868760 (1 EST) Length=362 TTTAAATGCGCTCGACTGGCAAAAAAAAACAAGAATTTTTTCATACTTGCCATACATACAAAATACAAATCTTTACTCTG ACTCTGATTCGGGAAACCACATAATCGCATTGCCCTTCATGACAGGATGGTAAAGGGTAAATTCCATCTCGCCACAAGAA TACAAAGGAACACCGCATGTGTTGCGCATTTAAGAGAGAATGAACAGCCATAGCACTTTTTTAAAAGTCATTAAAATGAT TTGTGTGTTGTGCACCGTTTCGTTCCTCGAGCCGCTTTTCCTCTGCTGTTGCTGCCGCTGCTGGTGCTCCTCGCACGTGT ACGCGAAAAAGGATGAGGTTGATGATATGGTGCGTGTGGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868760: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687603482767AI110347TENU3318T. cruzi epimastigote normalized cDNA Library


Date: 0:20:15 on Sat 25 Nov 117.