EST 1868763 is a singleton


Sequence

>1868763 (1 EST) Length=330 CACAGCTAATTTTTGTGGTACCGCGGGTTACACTCTCTATGGTTCCTATCACTTCGCAGCAAACTTTGGAAAAGCCAACA ACTCTTAGCGTCAAAACGAATTACCATTTATGGATGTCAATATTGGAAGGAATGATTCCAATTATCTTGGTTCATCCCTC TGTGAGAGTTAGGGCGCATGTTATATGTTCGCTATGGGCTCTTATTGAACAATATGCTATTGCGTTTGCCACAAATATAC AAGAATCTCTTTTTACTGGAATTCTAAGACCTGTTTTATGTAACCTTCTTATGCATGCACCAGTCGATCAAGAAACAGTT ATTGATCCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868763: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687633482770AI110350TENU3321T. cruzi epimastigote normalized cDNA Library


Date: 17:15:52 on Thu 23 Nov 117.