EST 1868766 is a singleton


Sequence

>1868766 (1 EST) Length=399 TGGCGTCTGTGAAAGTTCATGACACATACAGAAATATATACAGAAACACACTGCGTACAGAAGTACTCTTCCTTTCTTAC AGCTCTTGTATGACATCACCCAAAGCAACACAGGCCCCTTCGACTCAGTATGTTTTGCCAACGCTGCGCCCTACAAAACA GTGGGCTCAACAGATCTCCACCGGCGCTTTCAGACCACCGAATCCGTTGGTTCACTTGGCACACCGCGTTAGGAGTGACG TGGCAAAAACGGAGGAAAACAATTTACGTTTCTCATCTTTTCCCAACTCACCTTGCGCAATGCTCCTAAATCAGTCTCAG TCCCAGACCCAGTGTACTGAAGATATAAACGACACCATCGAAAGAATCATGAGTATGATTGCGAGTGCAGTTGGACAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687663482773AI110353TENU3324T. cruzi epimastigote normalized cDNA Library


Date: 23:32:2 on Fri 17 Nov 117.