EST 1868767 is a singleton


Sequence

>1868767 (1 EST) Length=361 GAAGGATATATTTTTTGCCAGTTGCTATTTGGGTTTGTATGATGCAAGTAGGCGGTGGTTATGTGAGCTCTTTAGTGTGT TTTCGCAGCAGAAGTGGGGTCCTCGCGCAACCGTCATAGTGGGAGATTCCACGGAGTATTTTACGAGTCAATCAGCATTC CTTGCAGGCAGCATTGCCTCCATGGCTACATGGACCCTCCTATATCCACTTGACACCATAAAAACAATTGTACAGGCCCG CAATATTGGCTTCTTGCAGGTGACGGATATCTTTAGGCGGGAGATTTCCGCAATGTACCGGGGAATTGGGGTGTCGCTGG TGAGGGCGGGCCCTGTGAGCGGTGCGCAATGGTGGTGTACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868767: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687673482774AI110354TENU3325T. cruzi epimastigote normalized cDNA Library


Date: 8:37:23 on Fri 24 Nov 117.