EST 1868768 is a singleton


Sequence

>1868768 (1 EST) Length=213 GTCAAAAGGAAAGGAACGAAGGAGGTATCAATGGCTATTGTCGTCATAAAGGAGCCGAATCTGCGCAACTGCTCGCTGAG CAGCAGCTGCTGCTCTCTACGCTGCCGCAGCCCCCAAGCCCGGTCTCCACGTACCTGACGGCTCCCGTGGCGCCCCTCAC CAGCGTGTACCACTCGCGGGGATGTGTCGAGCTCATCGAGGATCAACCCGCGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868768: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687683482775AI110355TENU3326T. cruzi epimastigote normalized cDNA Library


Date: 8:20:40 on Wed 22 Nov 117.