EST 1868772 is a singleton


Sequence

>1868772 (1 EST) Length=338 CGGTGGCGGAGATCTGTAGGCAAACACCGCAGTGAGAAGAGCGACGCAGACGAAAGGAAAGATACATTGCTCTCAATCGA TATTGACGCGGTTTCTTCAATATCTTTCGCCAGTACTTCCTCCGCGGAGTCTGTTGAGACTCTTGAAATGGCGCACAGCT TCTGACTGTGTGCGACAGGGCAAAAGATGGGCAGGCACGCCGTGTGCGTTTTGTAAGTCGAAGTCCTCAAGTCCTATCCA ATGCTGTGGAGGCATTGGCTGCTGTGGCGGCAGTGGAGGGGGAGACGTGAGAAAAAGCACGCGGAACCCCATTGCCGCTC TCCCAGGCATCTCAGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868772: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687723482779AI110359TENU3330T. cruzi epimastigote normalized cDNA Library


Date: 23:25:3 on Fri 17 Nov 117.