EST 1868787 is a singleton


Sequence

>1868787 (1 EST) Length=282 ATGCGTCGTCCAGAGATGCATATGCGCATGTCATACCCCGTCAATCGTGTCGCACCGTGGATGCCAAAGGTGGCGGACCA GACGGCCAATGCGTAATTACGCTTTGAATATTAGCGGATAGGAGCTGTCGTGGCTTTAGAATATAATATAGTACAATATG TATATATATATGTATGTATGTATGTATGTAGATGATGAGTGGTATCGAAGCTATGGCCTTGAAGGGAGGGAGGTTCTGGG ACAAGGGATGAGGGAATTTAGTGAGAAATTGTTGATGGATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1868787: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687873482794AI110374TENU3930T. cruzi epimastigote normalized cDNA Library


Date: 0:14:37 on Fri 24 Nov 117.