EST 1868793 is a singleton


Sequence

>1868793 (1 EST) Length=348 CCAGGAAGGGGTCATGTGCATCTCTACCGGCGTTTTTTATGACGTGTGTATTGAGGAAGAGTCATTTTTCCCATCAGGAG CGTACGCACAGGTGACAATATCACGTGGGGCCATCGCCGATTGTCTTAGTGAATTGTTACAAGAGACGCCTATGATAGTT GCCTTTTTGGCTACGGGAATTCCTTTCTCATTGGAGGTGGAGGAAGTGGTTGGCGAGGAGTGTTTGTTGGAAAGAAAACT TCTATTCCTCACTGTGCGCGGTGTACTGTTTGGATGCCGCTTTGATGTGATGACATCTGTGTTATCTCCAGATAACACCA TAGAAGAAGCACTGTCGAATTTGCCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868793: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687933482800AI110380TENU3936T. cruzi epimastigote normalized cDNA Library


Date: 12:46:44 on Sat 18 Nov 117.