EST 1868797 is a singleton


Sequence

>1868797 (1 EST) Length=404 GAGAGACACTTGTTTCCGTGCTAGAGCGCTGTCCGATGCCCCGGCAGACTGTCATGTTCACCGCCACATTGAGTGAAGCG TGTGAGGAGGTGGCGCTGAAATATTTTTCACCGGATGGCTTTATCGTGGTGCGTGTGCCACACCGCTGCTCAACCATCAC GCAGGTGTTTGAGATGGTGCCAAGCGACGCGGGTGCGATGGCTCCTGCGCCTGCCACCNTCGCGGCTCGCAGTGATGTGA ACAACCACGATACCTCGCAGCAACGTTCAAATCAGCCGCAAGTGGAGCGCCGCCGTCACCCGCTGTTGCATCCCATGAAG TTTGCCCGGATTGTAACGTACTTGGCGTACGCAACCGCCCCCGTCGTGGTGTTTGCCAATGAAAAACGCACATGTGACGT ACTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868797: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687973482804AI110384TENU3940T. cruzi epimastigote normalized cDNA Library


Date: 0:30:41 on Sat 25 Nov 117.