EST 1868798 is a singleton


Sequence

>1868798 (1 EST) Length=383 GCGGACCTCAGCATCCGCTGGGAGGCGTACATTACAAGCAATATGAACGACGGGGACTCCCTTCAGTGTGAGCGGATGCA GCAACTAACCGTCTGCGTCGAGGCGGAAACGCGTCGATGAATGTGCTTCTGGCCGAGATGATTTCGAAGACCCTCTACAA CGGCAGCATGCCGTACCCCACGAACCGCATCACAAATCTTGACCGCGTCGCGGTAGAGGCGGAGAGCAGAGAGGCGAGTT TGGCAGAAAAGACAACAGTCGAAACGACGCCGAGCCGCGGCCGGTGGAGGCGACTACTCAACGTGCAGAACAAACTCCAT CAGGCCATCTCACACGCCCGCGCCATTCTCGTGTCGGGAAATAAAAACAAAAGTGAGAGACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868798: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687983482805AI110385TENU3941T. cruzi epimastigote normalized cDNA Library


Date: 2:48:25 on Tue 21 Nov 117.