EST 1868799 is a singleton


Sequence

>1868799 (1 EST) Length=335 GTTCGCCGGTGATAGCTTCCTTTTCTTTTTTTTCTTCTTTGTTTTTCCTTTCCCTTTCTTCTGGGAGCATGTATGTGGGT TCGTACCGTTTATATTCAGCGAGGAACGAGATGCAATGGCGTTGGCGCAACTGAATTCATGGCACTGGCAAAATTGGAGG CTACTGTTATTATTATTCTGCAGGGTGTGCAGCGAGAAAACTGCAGAGATTGCCTGCGGTGCCTTTTTTTTTTTTTTTAC TGTTTGTGTCGTTTTCCCTCGTCTCCCCTCTTGACTGCCTGTGCTGCGTGGCAAGGAGAAGGACGGAAACAACCAAACAA ACACCAGAAGAAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1868799: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18687993482806AI110386TENU3942T. cruzi epimastigote normalized cDNA Library


Date: 11:57:26 on Fri 24 Nov 117.