EST 1868808 is a singleton


Sequence

>1868808 (1 EST) Length=166 CATCCGATGGCGATGACGACAGGCCGCAGAAGAGAGCTCGTGTAGGAAACACATCGAGGGCTGCGCGCTTCCGACCAGGG GAAAGGCAGCTCGCATGCCAAATCCTGGAAGCGCAGTTCCTCCCCCACGCAGATTTTAATTGGGCGCACCTTATAAAAAT ATATAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868808: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18688083482815AI110395TENU3951T. cruzi epimastigote normalized cDNA Library


Date: 6:40:14 on Tue 16 Jan 118.