EST 1868815 is a singleton


Sequence

>1868815 (1 EST) Length=378 AAGAGTCTTCATGGTACGCTGAGAAGACTCATCTTGAAGAGGAATTGGGGTCAACTCAACCACCGGCACACGCTAGTACA TTCAGTAACGTCGTTTCACCCTCATTTACCGTTCAAAATGGACCCACATCCATAATGTTGTCGTCCAAGCACCGGGCCTC GGAGACGTCAGGAGTGGTCGGAACAAGAAGATGGCCGAGCCGCCAAATCTGATTTTGAAATGTTGACTCTGGAGGAGCAA AATTTGTTGGCGGATCTCCAACGAGCATTGAGTCAACAAAAATAAATTTTCTTTCCACACCCCTTTTTTGAATTGCGGTG AGTGAATTAATGAAGGGTGGAATTTTATATGCTGCGCCTGTCATGATGCGGCTGCTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868815: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18688153482822AI110402TENU3958T. cruzi epimastigote normalized cDNA Library


Date: 17:56:24 on Tue 21 Nov 117.