EST 1868829 is a singleton


Sequence

>1868829 (1 EST) Length=366 GTGACATCCATGCACTGCGCCACAAAAACTCGGCGAGTACCCAGCGCTATGTTGCCGAGGCTCTTGCCTCCGAGGAGAAC ATCATCTTCTGCGGTGCCTATCATACAGGCAAAATGACAATTCTTAAGGCCATCGGTGAGGTGTGTGAAAAGAAGGGGAA GAAAGTGGTTTATGTGTCTGCGGATTCAAAACGTGCCTGTCGCATAGACGGAATGCTGCTGCATCACTTCCTCGGACTGC GCTACTTTGGGAAAAACGAGCTTCCGTCGCAGGATCAACTTGAGGGCGCTTTGGGGCGTCATGCGCGTCTGTGCGAGTCC ACATATGCCTCTTGTGTTCCCAGCCTGGCGACGGCGGATGTATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868829: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18688293482836AI110300TENU3972T. cruzi epimastigote normalized cDNA Library


Date: 19:1:55 on Thu 23 Nov 117.