EST 1868924 is a singleton


Sequence

>1868924 (1 EST) Length=409 TCATTGCTGTTCTTCTCTTCTCCGTCTCATCATTTCCCCCCTCCCCTTTTCTGGGCTTAGTACCAGTATTTGTACGACCA ATGTTGTGTCCAGTCGTAGCCAGGGATATAGGCACAGTAGCCAAGGTAACTGTACACTGGCTTGCGACTGTAGAAATAGT GTTGCAACACTTCCTGGACGTTTGTAGGGGTCACGTCGTCAATGCGGGCGTACATCTCCTCCAACGGAATACGACGACCG TAATGTAGCACTTGCTTGCCGATATCCTCCGCGGAATTGGTGCTGCCGTCCATGTTAAACAGGAGTTGTGATTTAAGGTT CACCTTGGCCTGTTCAAGTTCATGCTGGTGTAACATCTTTTGGCATATGCGGCACCATTCCGCCATGGTATACTGGAACA CCTCAATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868924: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689243492561AI110507TENU4058T. cruzi epimastigote normalized cDNA Library


Date: 12:5:2 on Thu 23 Nov 117.