EST 1868930 is a singleton


Sequence

>1868930 (1 EST) Length=344 TCCCGGTGTTTCTGTTGCTGCCGGAGAGGAGGGGTTTGCTGTTCGCCGCACCGCCAGCCCCACCGCCCTGCGCACCAGCC GCTTCTTAATGTCCATCGCCATCCTCGTGAAGGCCTCCTCGACATTCGATGCCTCCTTCGCGCTGGTCTCGAGGAACGGA ATGCCAAGATTGTCAGCGAAGTCTTTCGCCATCTGCGTGTCAACGGCCTTCTTGAGGACGAGGTCGCACTTGTTCCCAAC AAGCAGCTTGTTCACATTCTCGCTTGCAAACTTGTCAATCTCAGAGAGCCACGTCTTGACGTTGTTAAAACTTTCCGTGT CTGTTGTATCGTACACGATGATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1868930: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689303492567AI110452TENU4064T. cruzi epimastigote normalized cDNA Library


Date: 7:18:2 on Mon 20 Nov 117.