EST 1868934 is a singleton


Sequence

>1868934 (1 EST) Length=333 TACCGCAAGACCGTATATATATATATATATATGATGGATAGATAGATATATATATAGAGAGAGAAGGGGAAAGAGAGAAA GAAAGAGAAAGAACGACCTCTCCCCGTGGATACGTCAGCCGCCTGCGGTGGTGTTACATGACAAAAAGAAGAGAAGGAGC AAATACACCAGTCCTAGTAGCCGACAACCAATCAATCAATCAATCAGTCAATGGTCATACTTATTAAATAAGTTCCTCGA CGGGCTTTTATTTACCCACCAACACGTTTTTTTTGTATTGAGCCGCTCTGTCCCTTAAAAAAGCAAAGAACCACATGTAT ATATTGGTATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1868934: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689343492571AI110456TENU4068T. cruzi epimastigote normalized cDNA Library


Date: 15:40:25 on Fri 24 Nov 117.