EST 1868940 is a singleton


Sequence

>1868940 (1 EST) Length=367 TCACGCACACAGACACACGGAACGAGAAGGAAGAACAGTGCAAAGAGAACACACAACGACTGCCACCAGCAGCAGCAGGA GTCACGGCGGGTGCGTCGATATTCACGCGTCAGCACACACCGAGCGACGTCCACACACACATCAACCAACGTAATGCAAA AGAACACGACTGTCCTTTGAAAAGCACACGAACTGCCGCCAGTCATTTTACTGTTCACCCTTCCAATGCACATCACCCGC ACAGGCAAAGAATCCCTGACCAAAGTTTACACAGCACAGGAGATACAAATCGGCACGTGCAGCCGCTGGGCGGAGATCAA TCCGCACTTATACCAGTNACCCTAACCCACAACACCCAATCGACTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1868940: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689403492577AI110462TENU4074T. cruzi epimastigote normalized cDNA Library


Date: 12:34:31 on Tue 21 Nov 117.