EST 1868951 is a singleton


Sequence

>1868951 (1 EST) Length=401 TAAAAACATAGAGATAAATAAAGAAGAAACGTTTCAAAAGAAAAAAGATTACAACGTCCGCACTTCGTAAGAAAAAAATA TATTTTTTTTTTTTTTTTCTTCTTCTCTTCTCTTATATTTTCTCCACGTTTGGAGTCGCCTCGACCGCATCCAAATCCGC CGTGTGGTCCTCACGTGTCGCTGGCATCACTCGGATCGCAGAACTCCTGCGCCGCATGCGAAAATATATGAGCTGCCCAA TGACCACGAGATCAAGAGATAACTGAAAAATTCCACAGAAAATAAAAGGAAATGGCTGATGATCAACAAGGAAATAAATC ACTTTAATGATATCGCCCAAAAACCATGTCAATACAAGCATAATCGTTAACCCTTCCGTGGATTGTCGACGGTGGTTACG T


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1868951: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689513492588AI110473TENU4085T. cruzi epimastigote normalized cDNA Library


Date: 4:1:46 on Sun 19 Nov 117.