EST 1868956 is a singleton


Sequence

>1868956 (1 EST) Length=414 TGTATACATGTAGCGACAATGTGAATAGCAAAGAAGTCATACACATATATTGAAATATATTGTCACTAAAACAAAAAAAA AAACTGGAAACAAACCTCTCCATTTCACTCTCAAACTCTATAACGCTTTCCTTTAAAATTACTCTCGTCCGGAGGTGCGG CTCGCAGGTTCAACGGTCATCAAGCTCGCAACATATAAAAAACAAACAATTAGAAAGGCACCCATATATATATATATATA TAAACGACGCACACATGCCAGAGGAAAACATAAATCTCAAATCACTCCAACTACATCACTTATTTGCAGGTGCAAAATGT GAAAAAAAAAAAAAAAAAACAGGGGCCTGTATGACATTTATACAAGTATTGCCCCTACGCCTCCTTTCCTCCTTCTCCTA CGAACACATACACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1868956: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689563492593AI110478TENU4090T. cruzi epimastigote normalized cDNA Library


Date: 10:40:8 on Tue 21 Nov 117.