EST 1868959 is a singleton


Sequence

>1868959 (1 EST) Length=412 TGCGGTTGTTTTCATTTTACTTTTCTGCGCTTTTTGGTTGGTTTGTTGGTTTTTTTGGTGTTTTTTTTGTGATTGTCGGT CGGTGCCTGCGGGCCCTCACGTGCCGTGTGTCGTTGAATCAATCCATTCACATGATTATGTTACATTGTCGTGCTCACGT TTAACGTGTGGGGTAATTTTGAGAACAAATGACCGGTGACGGTCGGACCGCTGGGTCCATGCGTACAGACCCGCTTCTCA TTGGCCCACGTGGCGGAAGGGGCAACGTGGAGAGGACGCGTTTCTTTCTTTTGTTTGTTTTGTTTTTGTTTTTGTTTTTG TTTTTGTTTTTGGGTTTTTGATCGCAACTGTTTTTATTTCCTTCACTTTGAAGCTGCGATTTTTCCGGCGGCGCAGCAGC GCCTACAGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1868959: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689593492596AI110481TENU3991T. cruzi epimastigote normalized cDNA Library


Date: 16:21:16 on Mon 20 Nov 117.