EST 1868963 is a singleton


Sequence

>1868963 (1 EST) Length=325 CCGTGTGAAACGCCTACAGCGTCCCCTGAAGAGGGAGACAAGAAGGGGGTTGTGTTGTTTCCGGATAACGCTGATGCCTT GACACGGACAACGCAGATGGAGCAGCATGGATTTTTCTTTCCAAGTAACCATCCATTTTGGGGCAAGCAAAGCGAGAGTG CCGCGACAGCTCCATTTCTTCTTATGCAAAACATTCGTTTACCCCTAACTGCCATGGTGATTCCTCCTGCCCAAGATGGC GTGAAGACGAATGCGACGGCGTACCAGAGGGATTCCTCATTTCTCTTTGTAGTAAATGGCGTGCGACGGGATCCCTCATT TGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1868963: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689633492600AI110485TENU3995T. cruzi epimastigote normalized cDNA Library


Date: 16:28:49 on Sun 19 Nov 117.