EST 1868967 is a singleton


Sequence

>1868967 (1 EST) Length=332 TATAAATTTAAAATAAAAAAAAACGATACAAAAAAAAAATAAATAATTCAAAAGAAGACACAAAAGAAAAAAGAAAATAA AATCAACAAGGCGGTAGCATCCATCCATTCATCTATTTTATGTTCGTCCCTTTCCCCAACTGTAACACATCTCCGCATGT TCATGTGTTACCACGGCTGACGTTGTGGCTGCAACAACAACAACAACAACATGAACGCCTCAACAAAGGTGTTGGAAGAG TCACGACGTCCATTTAGCACCCTTGGCGTGGGCGCTCAGGCCAGTAATCATGTTGCTCCAGTCCGCTGTCAACTTGTGAA GCTCATCCAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1868967: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689673492604AI110489TENU3999T. cruzi epimastigote normalized cDNA Library


Date: 15:2:44 on Thu 23 Nov 117.