EST 1868969 is a singleton


Sequence

>1868969 (1 EST) Length=440 TCATGCAGCGAGAACAACACACAGATGGAGGAGGGAGAGACCAGCAAGGGCGGCACACAAGGCCCCACCACATGTACTGC ACATGGCGAAGGCGTCTGTCGTTTCCGCACCCCTCACGGACGGCCTTCACGCAAAAGTGGAGGCGCAGCGCCCACAGCAA CAAAAAAGCAATGAAACAAGAAAAAAGCAATCCCCGCACACCACGAGAATTCATTTTCCACGGTAACTGCAGGCAATATT CATCACAAGGACAATATAGTTTCCTCTGGCCTTCTCTCGCCTTCAGCACACGCCACTTCATGCAAGCGCAGCCACCATCG CGGCAGCAGCAGCAGCACACACACAAGAAGCAAAGTGAAGGAGTGGACTGGGAGACCGCGGTGCTGCGGTGCTGCCGTCA CCGTCGCCAGTAGCTGCCGCAACATTTGCTCTGGTGGTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1868969: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689693492606AI110491TENU4001T. cruzi epimastigote normalized cDNA Library


Date: 18:5:29 on Fri 17 Nov 117.