EST 1868976 is a singleton


Sequence

>1868976 (1 EST) Length=259 TACAAGACGACATTCCGCAATGATTCGGCCCAACTTTCATAAAAACACACGCAAAAAGGAAGTGAGAGAGGGAGAGAGGG AGAATGTGTGTATGTGTATGTGTATGTGTGTCATACATTCATGTATATTAGATAAATACATATATATATATATATATATA TATATACGGGGGGGATTCACACATACACGCATACACGCACACGCACGAGACACAATAAAGAAATGTAGGAGGAAAAACAA CTTACCCTCTTCTCAGCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1868976: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689763492613AI110498TENU4008T. cruzi epimastigote normalized cDNA Library


Date: 12:23:18 on Fri 17 Nov 117.