EST 1868978 is a singleton


Sequence

>1868978 (1 EST) Length=350 CCGCCTCCTGCTGCGCCGTTTCCTCCTCTTTCATGAGTTCCTTCCATTTCTGCGCAACGAGTCTTTTGGACTCAAAGTAC ACATTAGAAATAAGCATCTTTCGAAAAGCGAGACTCGTGTTAAGCACTAACGCGTCCACCTCCTTGAGAAAATCCTTCAG AGCGTCCTTGGCAAGCATTAGGGAAACATCATTCTGTGAAACCTGCCCAGAGAGTAACGGTTCCCGCCCAATCTTGGAGA GAACATTGCTAAGCCTACCATCGCTCACATTGTTTAACAGTAGATTATTCGCGGCGGCCTCCACCTGCGGAAGCATGGAA TCTGCAATCACTGTAACGTCCCCGCGTACA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868978: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689783492615AI110500TENU4010T. cruzi epimastigote normalized cDNA Library


Date: 6:11:22 on Wed 22 Nov 117.