EST 1868981 is a singleton


Sequence

>1868981 (1 EST) Length=426 TAATAATGGCGAATTCATCTGATAACTGCAGTTTCCCTCTGGGACAGACGCCACTTCTTGAAAGCATTTCCAAGTGCCCT CCCTTTTTTTTTTTTTTTCCTTCTCCCTACTTTTCCGTTCATCAATCGGAATAAAACCTTTGATTTTCATATATATATGA AAATAAAATAGATAAATAGCTTTTCCTTTTTTTTTATTATTTATTTTTTGTTTGCGTGTCTGTTTGGTGCGCAAGGGAAG AAAAGGGGACAATCTTTTTTTCATGAGTTAAGAGAGAGAGAGTGAAAGGCGGTTAACAAAAATAAATAATAATTGCGCCC ATGCATACAAGGGGCCCATCTTTATTCCTATCGTTCATTTCTCTCTCACACTCTCAATGACTGCGTGTGCTCCCCCCACT CAACACGCATGAATTCCCCCTTCCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1868981: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689813492618AI110503TENU4013T. cruzi epimastigote normalized cDNA Library


Date: 15:25:48 on Fri 24 Nov 117.