EST 1868983 is a singleton


Sequence

>1868983 (1 EST) Length=407 TCTCACGATGCGCGCACATCACCAAAGTGCAGCAAGGAACGCACCTCCTCTGCGTTGGACGGGCAGTCAACCAGCAGCGT TCGCGCTACACACTCAATGCGTCCGCAGACATCAAATTCCACCTCGTCGTAAAAAGAGAACGAAACATCCTTGCCGTTGG CTGCAAAGACGGAGCGCACCCCGATGACACGCGGGCTATTAAAAACACTCCACACCTGCGGCTGCCCTACGCACGTCCAC CGCTCCGTCACGGTCGCATTCTGCGCCGAAATCTCGCTAGCGACAACTTGCGCAGAGGCCAGTCGCTTAACGGCGCGGTC ATTACCATAGCGTAGAGCCAGCCTGCAGTAGGGACTCAGCCGCTCCTCTACGGAGCTTGCGGAACGGGCCTGCACCACAG AAAGTGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1868983: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689833492620AI110413TENU4015T. cruzi epimastigote normalized cDNA Library


Date: 10:45:35 on Tue 21 Nov 117.