EST 1868988 is a singleton


Sequence

>1868988 (1 EST) Length=270 TCACAGCCAGAGAAAGTGAAAGAAGCCAACGCCACACACACACAAAACAAAAAAAAAAAATCAATTAAACCACGCCGCTT CTTCTTTTAACATCCTTATCGTCTTCTGAATGCCCCATTAGCTGTTCTGCAGAATCCCAGCAAGGCTCTTCAGATCTTCC CGCACGTTTTCCACAATTCCAGTCAGCACCGAGTTCCCGAGTCGACGAACATCGTGAATCAAACGATTGAGTGCATGAAG AAGCTTTTCAAGCGATACCGAAAGCTCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1868988: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689883492625AI110418TENU4021T. cruzi epimastigote normalized cDNA Library


Date: 12:1:53 on Wed 22 Nov 117.