EST 1868990 is a singleton


Sequence

>1868990 (1 EST) Length=319 TGAGTGTCCAACAGGAGTCTCCTCCTCCAAAAAAATACACTTCAGCAGAATCATCATTTCGTACGCCATGCAGCAAAGCA GGACTGTGTTTATATGTACATGCGTACAGTACCTGCACAAGGAAAAAAATATTACTGTTCCACAAGCCCACACAACATCC CACACACGTCATGCGGCATCCGGCCTGTCTCTCCACTCCTCCTTTTGTGTCGTCCGTGGAGCGCACAGCCGTGGGGCCTG TACCGCGTGTGGGCAACAGAAGCAATCAAGAGGGAAAACAATTCGCTCATGACGGTGCGCACAACTGACCATTAAGTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1868990: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689903492627AI110420TENU4023T. cruzi epimastigote normalized cDNA Library


Date: 17:24:5 on Fri 24 Nov 117.