EST 1868996 is a singleton


Sequence

>1868996 (1 EST) Length=411 TGCAACACTAAGAGAAAAAATTCGGCCAAGTCGCGGAAAAAAAAAAACACAAACAAATAAATAAACAAAAAAAGACGCAT ATACAAGAAACCAGATAATGTATTCATCCGTTAATTTAATTTTATTTGTGTTTATTCCGGATTCCTCCTCAAACAGCACC AAAATGTAGCTCTCACCGAAGTATGCTTACGAAAAATAATAATAATCACTTCTACAACACATCCTATATCCCAAGCATCT CAAAAGGAAAGCAGGAAGTTTTTTTTATCACCATCGTTCAAATTCACTTGATTTTTTTCTTTTCCATGGCTGCCGCTGCA GTCCGCTTCCTCCGCAAATTCGCCGCGCGCCTGGTTTCGAAATATGCCATAACAGCACGCATTATGAAGGTTGTGATGGC AAATACCCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1868996: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18689963492633AI110426TENU4029T. cruzi epimastigote normalized cDNA Library


Date: 10:38:4 on Mon 20 Nov 117.