EST 1869001 is a singleton


Sequence

>1869001 (1 EST) Length=446 TACTATTATCTATTGCTTCATACAGTCTTACCCACCCCGCTCGCATAAATCCCCCCGCTTACCTTTACAGGTAAATATAT ATAACTCCGTATTTGTGGTGCACGCACCTGTGAGCAGGTTGCACGAGGCCACAAAATGCCGTCGAGCCTACAACTTCATC TGATAGTAAGAAAAAGAGAAAGAGATGGCGGTGAACTGGAAGAGAGCGGGGAATTCAAAGAAAAAGAAACCCATCAGAGA ATTCTGATCAGTAGAAGGAAAATTGGAGGACCGAAGAGGCGCACGCATGTAAATGTGCGGCACTACGGTCCTCCAATTTT CCTTCTACTCTTCCTTTGCCAATTACTCCTCCTCCTCCACCCGCGTATTTCCTCCCCCTTTTTTCCGTTTCTGTTTTTTC CCCTTTTTTTTCTTTTTACTTCAATTTATATATCCCTCTTCATCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1869001: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18690013492638AI110431TENU4034T. cruzi epimastigote normalized cDNA Library


Date: 10:33:56 on Sat 18 Nov 117.