EST 1869005 is a singleton


Sequence

>1869005 (1 EST) Length=431 TGTAAATATTACGACTCATAAGGCGGTAGGATTTTGAGGATCCTCCACCCACAAGACCCCACCGCGAGGCGAGCATCGCA GGAGGGTGTGAGTGGAACGNAAATTGAAAAATCAAAAGTAAAGAAAATATTCGTCCTACCGGCATCGGCTCTCTGATTGC GTCCATCGTCGGTTTTCACAAAACAATTAACAACACAGGTAAAAAAAAAATCGTAAATAAAAAATAATCTTCGTTCTTAT CAAGAAATATATTAATTTCCGCGGCCAGCATTCCTCGCAAACATCCTCTTCACAGGCTCCCCTAGCCGCTACTAAAAAAC ATGACGACATACGCTCATGAGTGCGGCCCCCACTGCCACGGATATTATTGCATATATGTACATCAACCTGCGGTTGTCAG AGCTGTAAAACCCAATCATTTCATTGACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1869005: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18690053492642AI110435TENU4038T. cruzi epimastigote normalized cDNA Library


Date: 20:56:18 on Wed 22 Nov 117.