EST 1869006 is a singleton


Sequence

>1869006 (1 EST) Length=429 TAAATAAATAAATAAATAAATAATGCATAAAAAACCAAAATAAGAAATAAATAATAAAATTTCCTAACCCTATAATTCAA CCAAGAAGATGCATAGAAAAATAAATCTCCACTGACGAGAAGAAAAAAAACAAACAAAAACAACAACACACCGATAAAAT GATATGCACATCGCCGTCCTGGTCGCCTAGATTTGGCGTAGTGCGGCCAATTCCTCCGCACTGAAGGGCGTCGCACTGTG TGGTAGACCCTTCTCCGTCATCAAGGCCAAAATACGGTTCACGGCCACACCGTACGTCGCAACATGGACTTCGTTGAGCA AACCAAAGCGACGATACGCTTCCATTGCGACCTCACGCATCTCTTGCTGTGCTCTCAGTCGTCGTTCCTCCGCATCCTCC GGGGCACGTTGACGTATCCGCGCCTGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1869006: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18690063492643AI110436TENU4039T. cruzi epimastigote normalized cDNA Library


Date: 20:38:57 on Tue 21 Nov 117.