EST 1869008 is a singleton


Sequence

>1869008 (1 EST) Length=387 TCAGCGACGTACAAAAACAGCAACAGAAGTGCTCGCGGTGATGAGCAGCTTGGAGGGCAGGCGGACAACAGCAGGCGGCC CAAGTCTGGCGCAGTGAGCATGGACGCCATTACATCCCTCACTGTGCGTGAGCAGGTGGATGCATTGGCGCAGGCACTTC TGCGAGAGTTTATGCACCGCCGCGGTTACACAAAAACACTGCAGAAATTTGATTGTGAGTGCCCACGCGATGAACGGACG ATTGCCTCACGACAATTGATGCGGCAGCTGCTGGAGATCCCCTCGCATGCGTTTCCCTCACGATTGAGTGGGGAGGGCGG CACACACAATACGGCCGTGATCATCGCCTCAGGTGAAGGGGAGGCAAATAACGAAGAGAAGAAGAGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1869008: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18690083492645AI110438TENU4041T. cruzi epimastigote normalized cDNA Library


Date: 14:28:58 on Sat 18 Nov 117.