EST 1869009 is a singleton


Sequence

>1869009 (1 EST) Length=504 TACCATGAAACAAAATAATAATACAATATATATATATATATATATATATATGGCTCTAAGAGAAAATCCCCGCACTCGCA TCAAACAAGCCGTTCATCATCTCCTGCGCTTCCGTCGTGTTGTAGTCTGTAGAGAGTACCTCGGCAATGTAGGGATCCAG CCCACTAGTAGCTCTCTTCTCATAGTACTCCTCTGCTTGAACCCTATTGTGCGCACCCGAATCAATAAATTCTAAAAGAT GGAACATGGATGGAAAAGTTCCGGCGATGGTGGAAGCCCGTCGTTCGGAAACAGATGATATCTCCAAAAGCATGTCAAGA TAAAGAGCGTGAAAGTCCGTCGGATCGCATTTTCGTCTTCCTTCCGCCCGAACGATTGGATCTCCTTCCAAATTTTGTTG TTTAATTGCCTTGAGACCATGGGCCACAGCAACCTCGGCCAATTGCTCAACAGAAGAAACAATGTCAAATCCAACTAAAA TGGACAAAAATGAATCATCAGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1869009: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18690093492646AI110439TENU4042T. cruzi epimastigote normalized cDNA Library


Date: 14:16:43 on Mon 20 Nov 117.