EST 1869021 is a singleton


Sequence

>1869021 (1 EST) Length=412 TAAGGAAAAGCCAGCACTCAAAAACTGAGTCGCCCACAGATATTATGGCAATTCACTTAGTTCATGAAGAATCTCAATGT TTTGTTTCTTTTGAGCTGCATGCTTCCAAGCCCACGACGACTCTTCGTCCTACAGCAAGTCATATTGTACATCCACTGGA ACGGGATCCTGTTTGTGATCACAAAAAAACTCCTCCAATTTCCATTTATGAATAGCCTTCGGATCATTCACTGCATCAAA GTGTGACGGCACCGACCTCGGAGGAGGAAGACTCGCACGTTCTTTACCATAATTGAAGTTGTACCACGACATCTGCAGAG CTGTCGTCTCTTTGGGTCCGACTTCACACTTTGCATGCTCCAGAAGTTTCAAAGATTCAAGTGACCAGCGTGAGATAACC GTCAACCCTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1869021: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18690213492658AI110451TENU4054T. cruzi epimastigote normalized cDNA Library


Date: 18:43:4 on Thu 23 Nov 117.