EST 1869410 is a singleton


Sequence

>1869410 (1 EST) Length=589 CTTCTAAACTGCCGATTTGATTTTCTCTATAATGTAAATAAAACAGTCTCGTTACAATGACATGAATAGTGTTTTCATGC CGAGATATTCAGTATCTTTGAGAAAGTGGTATCAAATTCCATTATATAAATTCTGTCTTAAGAAGTGGAAAAAGTTTCTA ATCGACCGAAAGATGTTTGGACAGTTAGCAAGATTGTGTGATTTCCTAAATAAGTACATTTCTTTTGGTTAACACAACTG CTCAAATTGGAAAGTAAGGATTGGATTGTGTTTTACAGAATTTGTCTTATCCGATGCTTATTATCATTGTACTTTAATGA CATAAAGCCTTGCATTGTGTNTTAGTTAGGAATTTAAAAAAAATAATATTGATATTAACATTAAACTAAATCTGATTGAA GATATTTGATATAGTCGTATACAACCCTTGCAATACAAGCTCATTGGCTCTTTATTTTTTATCATGAAAAGAAGTACCCT CACGTGCTAACATTATATGGAATATCGGTATGACTGATCAATTGTTTTGTCCAAAATCATAATATCGAGTGAATGCCAAT ACTTTGAGCCTCAATGTTAGCAATGGTAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1869410: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18694103509811AI111123MF003H11.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 9:56:46 on Wed 22 Nov 117.