EST 1869504 is a singleton


Sequence

>1869504 (1 EST) Length=352 GTTATTCGCAATTACTCTATACTCACTTCTATGTCTAAACGTTAACAGTGCACAGATGCCAGAGACAACAGAAACTAATA TAACATGTGAAATGAGAGAATCAGACTCAAACTCNCATAATACTCACATGAATACNAAGCAATCGAGACAAAAAGAAAAT CGAAATTCTCATGGAAACAGAAGTGATGAACACTCNAATAGAAATGATGTAGTCGGATTCCNCTCCTCAGATGAAGTATT CCGACTGAAATACTCAAATCAAAGAAGAAGTGATNTTTATACTAAAGGTTACCAAACNTTCCTTGGAAAGCGTAGACNAG GCAGTAAATCNCATGTGAGAACCACATTCAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1869504: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18695043509905AI110935MF002H09.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 7:27:12 on Sun 19 Nov 117.