EST 1869534 is a singleton


Sequence

>1869534 (1 EST) Length=302 GCGAAAGAAGATATAAAAATCCCTTCAGTTGTTCAAGGATTTCAGGCATTTAGCGGTACAGGTTATCGGTTAGATGGGAA AAATAAACAGGATAAAACTGATGAAGCAGATAATGGTCAATCATTAGGGCAATTGAAGGAAAGAGAAAGGGGTGTACCAA ACTACAATTATCAACCTGGAAGTTTAACATTTTTCCGAAATGTAAAACAAATTCCTGTAGAGAAAACAGAANAACCTGTA TTCAAACCATTCAGTGGCACAGGTCATCAATTGAAATCNCGCAAGAAATGAAGGATAGTNTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1869534: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18695343509935AI110965MF002F04.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 12:18:34 on Fri 17 Nov 117.