EST 1869565 is a singleton


Sequence

>1869565 (1 EST) Length=402 TGAAATGCGTTTACTATGTTTGTTTTTCTGTGCTGAATACTTAGATCAACCGCTTTGTTGACATTATTATTATTTCGTCA GATTAAATGATGGAATATTCTACAGTATTTTACNAACAAATGCTGTAAACTTTTTTGTCAGTTTGTCTTGTANAGTGATG GCAAAAGGTTGAATTGGTAGGATATTTTTGGCTCAGGTGTTGTGTATTTATGAACTGAGTATTTTTTTATTGTAAAGCTT TCATTGTCTTTTTCCGCTGAACGTTTAAAAGAATTTTGTAAAAACTGTGTACATGCCACACGGATCCAATATGCAATTCT AATAGTAATAACACAACGGTGTACTAGGATATGTTTGGGAAGTCATCCAAACNAGTCAAGACTCGCTGCACTAAAATTGC AT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1869565: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18695653509966AI110996MF002C07.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 3:57:8 on Sat 18 Nov 117.