EST 1869566 is a singleton


Sequence

>1869566 (1 EST) Length=340 GTGGTTGAGCTAACTTACTGGCTTGCACCGAAACACAATATGGGTATGGCTGTATCTCGTGTTGTCTGGAAAAATATTGA ACAATGCTTGAACTTATTCTGTTTTTATGATGATTATAATTGGGACTGGAGTCTACANTATNTTGGTCAAAATTGTTTCC CAGGCAAACTGAAGGCCTTGACTCTACCTCTTTCTACTCGTGTCTTTCATTCGGGTGAATGCCNAGGTCTTCACCATCAN AAAACCAGTTGCTCAACANAGTTNTTAGTAACANATATTTTACAAATGTTTAGTGGACCATTATTGACTAGATTNTTTCC AACATCTTTACTTTTATCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1869566: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18695663509967AI110997MF002C06.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 14:25:47 on Fri 17 Nov 117.