EST 1869569 is a singleton


Sequence

>1869569 (1 EST) Length=303 CAATTGTCACTGCGATTGCAAAAGTGTAGTTAAATTACATGCCAAACCTTTAGTGGATCCATTGCATATTTATTCCAATA AGCATNCAACTATACCCTGCCCTATCAGTTCTACTGAANAAAATGAANTTCTGTCCAATCAATCGTTTTATAAATTATTA AATGGATTCCCTAAATTGGATTTAGATGAACACNAAGAGCGGGTTTTGCGCAAAAAGGCATATNTTTCGTCAGTTTTTTC AGCAACTAATTCAAAAACAAAAAGAATATTTNCTGGAAGTGAAAAAACTAGAAACGTGAAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1869569: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18695693509970AI111000MF002C03.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 4:29:23 on Wed 22 Nov 117.