EST 1869608 is a singleton


Sequence

>1869608 (1 EST) Length=345 GTTTAACAATTATTATATAATAGGAATAATAATATATATTACTTCAATGAATTCAATTTATACNCATTCTAATTATCGTT ATAATGGATTTATGGATCAATCTAAAAAAGATTCATATGAGGCTATTAACTTTCCATTGAAAACAATTCATGGGCATAAA TATGATATGGATTATGGAAATGGATTTATACCANATAATTATGGTAATCATGATAACCATGATGATCAAGANTATGATTC ATATCATAGTAATGATTATGATGATGGTGAAGAGCACAATTATGGTCATGTTTATTTAACCAAACCATTCATTGCTTAAN TTAAAAGAACTGAANCATCGTAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1869608: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18696083510009AI111039MF001G09.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 3:58:1 on Thu 23 Nov 117.