EST 1869635 is a singleton


Sequence

>1869635 (1 EST) Length=361 GTGAATATTACAATTACTATTAATAGTAGTATTAAACATAAAATTTCTCAAAATTATATTGAACCATTTCAATTTAAAAA GAAACAGAGGTGAAGTTATAACGCCGACGTTGAAATTGTCTGATTTATTTTTAATAAAGAACTCCTAATTTAAAAATTAC ATGATGGAAATGTAAAGAAAAGTTAAATAATAAAAAAATTTATTAAAATTATAAGGGAGTGAAAATAAAATCGATGTNAC GGCGAAAAAAATTTTTGATGGACGGTTTGTTTGTTGACAGTTATATTATTAAGTTTTTTTGAAATCATCAATTTATTCGA TAATATTCCTTAGTTTTTATGGTTAACTAGACGCTCCAACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1869635: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18696353510036AI111066MF001D09.NK3S. mansoni, female enriched, subtractive, HHU(A)


Date: 17:38:47 on Mon 20 Nov 117.