EST 217617 is a singleton


Sequence

>217617 (1 EST) Length=166 GTTATATGACCAACTCATTATGGAAAAACTCCATTATCACAGTAACAAGTCCTTTTCTAAATCGGACAGGTTAGATATAA TTTNTATTAAAACAAAAGAAAAAACTCCGGGAATATTATATTCCCCATTTAAGAGATTTAATATTATNNNNGATCCTCCA CTCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 217617: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217617808439R47552SWAMCA001SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:9:59 on Wed 22 Nov 117.