EST 217678 is a singleton


Sequence

>217678 (1 EST) Length=199 GAGACNTGNNNCANTGGTGTGAAGATAACGAATGTTTGATATACACAGACACATGGTGTACAACATGAGTTGTTGCAGAC GGTGATTTAAGGGAGTGTCCATTAGCACACTTCTAGGGANNATCTGTGGCCCTCTCCTGGCCTCCCCTGGATTCCACAGC GGCAGGCCCATCGGAAATATAAGAATTTCTGATCCACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 217678: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217678808500R47613AS3ISA055SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 5:15:10 on Sat 18 Nov 117.