EST 217706 is a singleton


Sequence

>217706 (1 EST) Length=312 GCCTGCCATTGAGATCGTTGCCTATGAAAATAATAATGACATCTGCCGATGAAGAGTTATCGGAATGTAGTGAAGTATTT AGTTAGTTCGATTCAAAGGGAGATGAACGGATAGGAGTAACACAAGTTGGTGATGTTCTTCGTGAACTTGGGACAATATC CAACAGAAGCTGAGATCCAGAATTGTTGTCCACATTGGACTGATCCTGAAACTCGTTTTACATTCGAAGATTTAGGCCCC ATCCCATCAGTCAGCGGAATAAATGTCGCGATTTCCATACTCTAGAAGAATTCGATCATCAAGCTTCATCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 217706: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217706808528R47641AS3ISB037SLBrugia malayi infective L3 JHU93SL-BmL3


Date: 16:30:13 on Fri 17 Nov 117.