EST 217766 is a singleton


Sequence

>217766 (1 EST) Length=164 AATAAATATGTTATATTATTAAGTATNTTAATTATACTTGTAAATCCAAGCAATTTCTTCAACAATAATATTATTCAACT TACATTTCATGAATCATTTAATGATGAAATAAAGGTGCATTATACATTACAAAAATGTTTACATGTCGGATTAATTGTCC ACAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 217766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217766808588R47701SWAMCA168SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:5:52 on Thu 23 Nov 117.